10x Genomics
Chromium Single Cell Immune Profiling

Cell Ranger7.0, printed on 11/05/2024

Reference Support

Table of Contents

• Making a genome-based reference package
• Input genome FASTA file
• Input gene GTF file
• Reference package output format
• V(D)J segment FASTA format
• Using IMGT

Cell Ranger provides prebuilt human and mouse reference packages for use with the pipeline, downloadable here. 10x Genomics reference packages are based on the T cell receptor (TRA, TRB) and B cell immunoglobin (IGH, IGL, IGK) gene annotations in Ensembl version 94 for the human and mouse references. These reference also includes multiple corrections to various V, D, J, and C genes based on empirical observations and to correct clear errors such as frameshifts, leader peptide truncations, and nucleotides that are never observed in rearrangements. These changes are documented in the release notes of each version of Cell Ranger. Refer to Prebuilt References for details on how these references were created.

If you would like to use your own genome FASTA or gene GTF annotations, Cell Ranger supports the use of customer-generated Ensembl-based references. Cell Ranger also includes support for generating a V(D)J reference from the IMGT database.

There are two ways to generate a V(D)J reference:

• Making a Genome-based Reference Package (e.g., using Ensembl)
• Making a V(D)J Segment-based Reference Package (e.g., using IMGT)

Making a genome-based reference package

The cellranger mkvdjref tool can be used to generate a custom reference package from a genome sequence FASTA file and a gene annotation GTF.

$ cellranger mkvdjref --genome=my_vdj_ref \
                      --fasta=GRCh38_ensembl.fasta \
                      --genes=GRCh38_ensembl.gtf

A Cell Ranger V(D)J reference consists of germline gene segment sequences. It assumes that these sequences are contained within a genome reference FASTA, and that an Ensembl-formatted gene annotation GTF points to the relevant gene segments.

Input genome FASTA file

The cellranger mkvdjref tool expects a FASTA file (supplied by the --fasta argument) containing genomic reference sequences whose names are consistent with the names used in the GTF file.

Input gene GTF file

The cellranger vdj pipeline expects a GTF file (supplied by the --genes argument) in an Ensembl-like format that contains information about V(D)J gene segments.

GTF columns

GTF attributes

Accepted biotypes

• TR_C_gene
• TR_D_gene
• TR_J_gene
• TR_V_gene
• IG_C_gene
• IG_D_gene
• IG_J_gene
• IG_V_gene

Example minimal GTF row used by cellranger vdj

14      havana  CDS     21621904        21621946        .       +       0       transcript_id "ENST00000542354"; gene_name "TRAV1-1"; transcript_biotype "TR_V_gene";

Reference package output format

A successful cellranger mkvdjref run creates a directory whose named is specified by the --genome argument.

$ tree my_vdj_ref
my_vdj_ref
├── fasta
│   └── regions.fa
└── reference.json

V(D)J segment FASTA format

The regions.fa is the V(D)J segment FASTA file. The header (first) line contains V(D)J-specific metadata. The feature_id and display_name are feature-specific identifier fields (see table). All other fields describe the V(D)J feature.

>feature_id|display_name record_id|gene_name|region_type|chain_type|chain|isotype|allele_name
SEQUENCE

Examples

>1|TRAV1*01 AF259072|TRAV1|L-REGION+V-REGION|TR|TRA|None|01
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
>979|IGHA*01 J00475|IGHA|C-REGION|IG|IGH|A|01
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

You can directly generate a FASTA file in the segment format and create a V(D)J reference by passing this file to cellranger mkvdjref with the --seqs argument, for example:

$ cellranger mkvdjref --genome=my_vdj_ref \
                      --seq=custom_segments.fasta

Using IMGT

Cell Ranger comes with a script called fetch-imgt which downloads the relevant sequences from IMGT and generates a V(D)J segment FASTA file. This is then used to generate a V(D)J reference package. Please note that we tested instructions for making IMGT references only in human and mouse. Customers using any other species must validate their IMGT references.

This example generates a mouse V(D)J reference based on IMGT.

# source the environment of CellRanger 7.0.1 for your shell (bash/csh)
# (for bash shell)
source path/to/cellranger-7.0.1/sourceme.bash
# OR (for C shell)
source path/to/cellranger-7.0.1/sourceme.csh


echo "version checks"
python --version


# Using a script that comes with Cell Ranger, get data from IMGT and create a FASTA suitable for use by mkvdjref
# The option --species is the name of the species for which the data is to be downloaded.
# The option --genome provides the prefix used to name the 2 output files. Only the file with suffix -mkvdjref-input.fasta is used as input to the mkvdjref utility.
path/to/cellranger-7.0.1/lib/bin/fetch-imgt --genome vdj_IMGT_mouse --species "Mus musculus"

# Build the CR reference. could also include Cell Ranger on your PATH to avoid specifying the full path for cellranger.
# The option --genome is a single identifier with no special symbols aside from hyphen or underscore. The reference will be placed in a directory created with that name.
# The option --seqs is the mkvdjref-input.fasta file generated by the fetch-imgt command.
path/to/cellranger-7.0.1/cellranger mkvdjref --genome=vdj_IMGT_mouse --seqs=vdj_IMGT_mouse-mkvdjref-input.fasta